آموزش تخصصی طراحی پرایمر

 –  عناوین :

بخش اول: طراحي پرايمر به منظور تکثیر یک قطعه DNA

فرض کنید می خواهیم جهش های احتمالی در اگزون شماره ۳ ژن SPP2 انسانی را در چندین فرد با استفاده از روش تعیین توالی پیدا کنیم. برای رسیدن به این هدف نخستین مرحله طراحی پرایمر های اختصاصی می باشد که در زیر به صورت عملی به همراه شکل آموزش داده می شود. 

 اطلاعات مربوط به توالی ژن از جمله اگزون ها، اینترون ها، پروموتر، توالی ها ی مجاور ژنی و پلی مورفیسم ها را می توان از بانک های اطلاعاتی از جمله Gene Bank  در NCBI ، Ensembl و … به دست آورد. در اینجا به سایت Ensembl مراجعه و در باکس جستجو، ژن SPP2 انسانی را جستجو می کنیم (شکل ۱). 

 Pars Gene

شکل ۱

همانطور که در شکل ۲ ملاحظه می کنیم، نخستین گزینه در نتایج نمایش داده شده ژن SPP2 انسانی می باشد. سپس بر روی SPP2 (Human Gene)  کلیک می کنیم.
1در شکل ۳ تمامی رونوشت های این ژن نمایش داده شده است که سه رونوشت نخست کد کننده پروتئین هستند و آخرین رونوشت پروتئینی کد نمی کند. همانطور که می دانید این رونوشت ها محصولات Alternative Splicing این ژن می باشند. برای دسترسی به توالی تمامی اگزون ها و اینترون ها بر روی بزگترین mRNA با طویل ترین پروتئین که در اینجا رونوشت    SPP2-001    می باشد کلیک می کنیم  و سپس درسمت چپ گزینه Exon را انتخاب می کنیم.
2

شکل ۳

 

در شکل ۴ توالی اگزون، اینترون به همراه طول مربوطه، و توالی های مجاور ژنی را می توان مشاهده کرد. اگزون ها با حروف بزرگ، اینترون ها با حروف کوچک به رنگ آبی، نواحی Untranslated Region (UTR) به رنگ بنفش، و توالی های مجاور ژنی به رنگ سبز مشاهده می شوند. اگزون شماره ۳ این ژن که ما به دنبال آن هستیم به رنگ آبی انتخاب شده است. همانطور که می دانید برای تعیین توالی کامل اگزون ۳ مجبور هستیم بخشی از اینترون ۲ و ۳ را در محصول PCR وارد کرده و پرایمر ها را در درون اینترون ها طراحی کنیم. دلیل این امر این است که به هنگام تعیین توالی (Sequencing ) معمولا ۴۰ تا ۵۰ نوکلئوتید اول دارای پیک مشخصی نیستند و امکان تعیین توالی وجود ندارد.

همانگونه که ملاحظه می کنید توالی کامل اینترون ها در شکل ۴ نمایش داده نشده است، به منظور نمایش کامل توالی اینترون ها  برروی گزینه Configure this page در سمت چپ کلیک می کنیم تا شکل ۵ مشاهده شود.
3

شکل ۴

 

در شکل ۵ با انتخاب گزینه Show full intronic sequence تمامی اینترون ها نمایش داده خواهند شد. از مهمترین قابلیت های دیگر این بخش می توان به گزینه Show variation اشاره کرد که با انتخاب آن می توان تمامی پلی مورفیسم های این ژن را به بر روری توالی ژنی مشاهده کرد. در صورتی که بخواهیم نواحی پروموتری ژن را بررسی کنیم در گزینه Flanking sequence at either end of transcript تعداد باز های مورد نظر را در مقابل آن وارد می کنیم. در پایان پس از انجام تغییرات مورد نظر گزینه Save  (به شکل تیک مشکی) را که در بالا سمت راست مشاهد می شود، کلیک می کنیم. که نتیجه این کار را در شکل ۶ می بینیم.
4

 شکل ۵

 

 

 

5

شکل ۶

 

حدود ۳۰۰-۲۰۰ باز انتهایی اینترون ۲ به همراه توالی اگزون ۳ و همچنین ۳۰۰-۲۰۰ باز ابتدایی اینترون ۳ را در یک فایل Word وارد می کنیم (شکل۷). در حدود ۵۰ باز پیش از شروع توالی اگزون یک علامت [ و در ۵۰ باز بعد از توالی اگزون علامت ] را می گذاریم (شکل۷). این براکت ها به این معنی هستند که  در ناحیه بین این دو براکت پرایمر طراحی نشود. 

 

6

شکل ۷

 

 

مرسوم ترین و در عین حال قوی ترین نرم افزار آنلاین طراحی پرایمر Primer 3 می باشد.

بخش دوم  آموزش نرم افزار طراحی پرایمر Primer 3

آموزش طراحی پرایمر با نرم افزار آنلاین Primer3 پرایمر یکی از مهمترین عوامل در موفقیت‌ یا شکست‌ در PCR محسوب می شود. در طراحی پرایمر اصول زیر را باید همیشه مدنظر قرار دهیم: – طول‌ متوسط‌ هر پرایمر بین‌ ۳۰-۱۸ جفت ‌باز باشد، پرایمر با طول‌ کوچک‌ اتصال‌ غیر اختصاصی‌ را افزایش‌ داده و پرایمر بزرگ سرعت‌ هیبریداسیون‌ را کم‌ می‌کند. – درصد GC پرایمر های مستقیم و معکوس نزدیک هم باشد که در حالت ایده آل حدود ۶۰-۵۰ درصد می باشد. – پرایمر های مستقیم و معکوس نباید مکمل همدیگر باشند، زیرا باعث تولید پرایمر دایمر می شود که به ویژه در Real time PCR مشکل ایجاد می کند. – در انتهای‌ ۳ پریم پرایمر باید حداقل یک پورین (G یا C) قرار گیرد ولی در عین حال باید دقت کرد که انتهای ۳ پریم غنی از پورین نباشد. – باید تا حد امکان‌ از توالی‌ های‌ پالیندرومیک‌ (برای مثال GTTAAC) در ۳ پریم پرایمر جلوگیری‌ کرد، زیرا احتمال تشکیل پرایمر دایمر را افزایش می دهند. – در حد امکان  تعداد پورین ها با پریمیدین ها برابر باشد. – از توالی های تکراری (برای مثال AAAAAA) در پرایمر، به ویژه در ۳ پریم جلوگیری شود. – دمای Tm ‌دو پرایمر نزدیک‌ هم‌ باشد.

نرم افزار های متعددی برای طراحی پرایمر وجود دارد که برای نمونه می توان به Gene Runner و OLIGO Primer Analysis  اشره کرد. اصول طراحی پرایمر در نرم افزار های مختلف شبیه همدیگر بوده و با یادگیر یک نرم افزار می توانید به راحتی  با نرم افزار های دیگر هم کار کنید. ولی باید بدانید که بسیاری از این نرم افزا ها مجانی نمی باشند.

نرم افزار آنلاین Primer3 یکی از بهترین نرم افزار های طراحی پرایمر می باشد و جالب است بدانید، پرایمر هایی طراحی شده در Primer Blast در NCBI با استفاده از Primer3 ساخته می شوند. در اینجا نسخه (۰٫۴٫۰) این نرم افزار آموزش داده می شود.

همانگونه که در بخش یافتن توالی DNA مورد نظر در بانک های اطلاعاتی” گفته شد، پس از آماده سازی توالی مورد نظر در فرمت FAST A، آن را در باکس Source Sequence وارد کرده و از بین ارگانیسم های موجود  Human را انتخاب می کنیم (شکل ۱). در این شکل توالی اگزون مورد نظر به همراه اینترون پیشین و پسین اگزون قابل مشاهده می باشد. علامت های براکت قرمز رنگ ناحیه ای که برای آن باید پرایمر طراحی شود را مشخص می کند.

7

شکل ۱

در حالت پیش فرض نرم افزار، پرایمر های مستقیم و معکوس طراحی می شود، در صورتی که بخواهیم برای TaqMan Real time PCR پرایمر طراحی کنیم، تیک Pick hybrizidation probe را می زنیم. اگر توالی پروب را از پیش به صورت دستی انتخاب کرده ایم آن را در این باکس Paste می کنیم (شکل۲).

در برخی موارد، توالی یکی از دو پرایمر برای مثال پرایمر مستقیم را داریم و از Primer3 می خواهیم پرایمر معکوس مناسب برای آن طراحی کند، در این صورت توالی پرایمر مستقیم مورد نظر را در باکس Pick Left Primer وارد می کنیم. کاربرد این روش در بخش PCR-RFLP بیشتر توضیح داده خواهد شد.

طول محصول PCR مورد نظر را در باکس Product Size Range وارد می کنیم که در شکل این مقدار ۶۰۰-۲۰۰ انتخاب شده است. در صورتی که نرم افزار پرایمری با یک توالی تکراری ناخواسته برای مثال TTTTT طراحی کرد، مراحل قبلی را تکرار کرده ولی این بار در باکس Exclude Region توالی تکراری را به صورت <TTTTT> وارد می کنیم تا دیگر در این ناحیه پرایمر طراحی نشود.
Max 3′ Self Comlementarity را می توان ۱ ، ۲ و یا ۳ انتخاب کرد ولی بهترین حالت ۰ می باشد. سایر گزینه ها را در حالت پیش فرض نرم افزار قرار می دهیم.

اختلاف Tm دو پرایمر باید کمتر از ۲ و در حالت ایده آل صفر باشد، بنابراین در باکس Max Tm Difference مقدار ۱ را وارد می کنیم. در صورتی که نرم افزار پرایم هایی با این شرایط پیدا نکرد می توانیم مقدار ۲ را وارد کنیم.

درصد GC دو پرایمر باید نزدیک هم باشد بنابراین در باکس Primer %GC مقدار کمینه GC را ۴۰ و مقدار بیشینه را ۶۰ انتخاب می کنیم. سایر گزینه های را در حالت پیش فرض نرم افزار انتخاب می کنیم.

8

شکل ۲

سپس گزینه Pick Primer  را کلیک کرده و همانطور که در شکل ۳ مشاهده می شود، مشخصات بهترین پرایمر مستقیم و معکوس و جایگاه پرایمر ها بر روی توالی ورودی نمایش داده می شود. نواحی داخل براکت ها با علامت ستاره مشخص می شوند.

9شکل ۳

سایر پرایمر های پیشنهادی در پایین صفحه نتایج نرم افزار قابل مشاهده هستند (شکل ۴) و می توان از بین این نتایج پرایمر دلخواه خود را انتخاب کرد. در مرحله بعدی احتمال تشکیل پرایمر دایمر بین پرایمر های مستقیم – مستقیم، معکوس – معکوس و همچنین مستقیم – معکوس حتماً باید بررسی شود. تعیین اختصاصیت و ارزیابی پرایمر های انتخاب شده و چگونگی اصلاح آن ها در بخش بعدی یعنی “ارزیابی کیفیت پرایمر های طراحی شده با استفاده از Primer Blast”  آموزش داده خواهد شد.

10شکل ۴

بخش سوم   ارزیابی کیفیت پرایمرهای طراحی شده با استفاده از Primer Blast

پس از طراحی پرایمرهای مورد نظر باید اختصاصی بودن پرایمرها را مورد بررسی قرار دهیم تا اطمینان حاصل کنیم که پرایمر های طراحی شد فقط قطعه مورد نظر ما را تکثیر خواهند کرد. برای این منظور به سایت NCBI مراجعه کرده و به بخش BLAST و سپس به Primer Blast مراجعه می کنیم. برای آموزش این بخش پرایمرهای مستقیم CCAGGTTTCCCAGTTTAATTCC و معکوس AACCCAGAATCCTGTCACCA را از نظر اختصاصیت بررسی می کنیم. این جفت پرایمر اگزون شماره ۱ ژن RB1 را تکثیر می کند. توالی پرایمر مستقیم و معکوس را در بخش Primer Parameters و در باکس های Forward و Reverse Primer وارد می کنیم (شکل ۱). در بخش  Database گزینه Genome Reference راانخاب نموده و در باکس ارگانیسم homo sapiens را تایپ می کنیم. سایر گزینه های نرم افزار را در حالت پیش فرض نرم افزار انتخاب می کنیم. در پایان بر روی دگمه Get Primer کلیک می کنیم ( شکل ۱). قابل ذکر است که با Primer Blast  می توان پرایمر هم طراحی نمود.

11

شکل ۱

نتایج عملیات فوق را در شکل ۲ مشاهده می کنید. در این شکل اطلاعاتی از جمله توالی، طول، Tm، درصد GC پرایمرهای مستقیم و معکوس و همچنین احتمال تشکیل دایمر را می توان مشاهده کرد. اختلاف Tm دو پرایمر حدود ۰٫۷ درجه سانتیگراد است که قابل قبول می باشد. بیشینه قابل قبول Self Complementarity برای پرایمر ها ۸ و در حالت ایده آل ۰ است. بیشینه قابل قبول برای Self 3′ Complementarity برای پرایمرها ۳ و در حالت ایده آل ۰ می باشد. محصول اختصاصی این پرایمرها یک قطعه ۶۳۶ جفت بازی است که بر روی کروموزوم ۱۳ قرار دارد (شکل ۲). نتایج Blast این پرایمرها به ما نشان می دهد که ممکن است محصولات غیر اختصاصی با طول های مختلف و در سایر کرموزوم ها (۱۰، ۳ و X) هم تکثیر شوند. حال سوال اینجاست که آیا این محصولات غیر اختصاصی در عمل هم تکثیر می شوند یا نه؟ برای رسیدن به جواب این سوال باید دو نکته مهم را مورد توجه قرار دهیم. نخست طول قطعات و دوم تعداد نوکلئوتیدهای mismatched در انتهای ۳ پریم پرایمر. وقتی که طول قطعات کمتر از ۲۰۰۰ جفت باز باشد احتمال تکثیر شدن آنها با روش PCR معمولی پایین است، بنابراین قطعات کوچکتر از ۲۰۰۰ جفت باز را از نظر تعداد mismatch ها مخصوصاً در ۳ پریم پرایمر مورد بررسی قرار می دهیم. در عمل وقتی که باز انتهایی در ۳ پریم پرایمر یک mismatch باشد احتمال تکثیر قطعه مربوطه به شدت کاهش می یابد. هرچه تعداد این mismatch ها بیشتر باشد به همان نسبت احتمال تولید محصول غیر اختصاصی کمتر می شود. با توجه به مطالب ذکر شده هیچ یک از سه محصول غیر اختصاصی در شکل ۲ به احتمال بسیاز زیاد در عمل تولید نخواهند شد، و می توان این جفت پرایمر را جهت تکثیر اگزون شماره ۱ ژن RB1 استفاده کرد.

12شکل ۲

 

در شکل ۳ بخشی از نتایج Primer Blast یک جفت پرایمر فرضی با توالی GTGTTGAGGAAGGCAGAAG برای پرایمر مستقیم و CACACAGCGGAACCTACAGA برای پرایمر معکوس را مشاهده می کنیم. آیا محصولات غیر اختصاصی این جفت پرایمر در عمل تولید خواهند شد؟ برای پاسخ به این پرسش نخست طول قطعات را بررسی می کنیم. محصول اخصاصی این جفت پرایمر ۲۱۲ جفت باز می باشد، دو محصول غیر اختصاصی این پرایمرها دو قطعه ۴۲۴ و ۴۹۲۶ جفت بازی می باشند. محصول غیر اختصاصی با طول ۴۹۲۶ به علت طول زیاد درعمل تولید نمی شود. حال قطعه ۴۲۴ را مورد بررسی قرار می دهیم. این قطعه محصول دو پرایمر مستقیم در کروموزوم شماره ۸ انسانی می باشد. در طول پرایمر فقط سه mismatch وجود دارد که دو تای آنها در ۵ پریم پرایمر قرار دارد. از آنجا که در ۹ نوکئوتید ابتدایی در انتهای ۳ پریم پرایمر هیچ mismatch وجود ندارد بنابراین احتمال تولید این محصول غیر اختصاصی بسیار زیاد بوده و این جفت پرایمر مناسب نخواهند بود. آیا می توان این پرایمرها را اصلاح کرد؟

13

شکل ۳

 

 

 

در پاسخ به پرسش بالا می توان گفت بله. از آنجا که محصول غیر اختصاصی فقط از طریق پرایمر های مسقیم ایجاد می شود آن را اصلاح می کنیم. برای از بین بردن این محصول غیر اختصاصی باید تعداد mismatch ها را افزایش داد. موثرترین mismatch آخرین باز در انتهای ۳ پریم پرایمر می باشد. طول پرایمر مستقیم را یک نوکلئوتید بیشتر می کنیم و این نوکئوتید اضافی را از روی محصول اختصاصی پرایمره انتخاب می کنیم که در اینجا نوکئوتید سیتوزین می باشد. پس از افزودن یک C به انتهای ۳ پریم پرایمر مستقیم دوباره نتیج Primer Blast جدید را که در شکل ۴ قابل مشاهد است را بررسی می کنیم.
همانطور که می بینید در محصول ۴۲۴ جفت بازی یک
mismatch اضافی در انتهای ۳ پریم ایجاد شد. این mismatch احتمال تشکیل این محصول را بسیار کاهش می دهد. باید دقت کرد که پس از این تغییر، اختلاف Tm پرایمرهای مستقیم و معکوس بیشتر از ۱ درجه سانتیگراد نباشد. در صورتی که اختلاف Tm دو پرایمر بیشتر از ۱ درجه باشد برای اصلاح پرایمرها نوکلئوتیدهای ۵ پریم پرایم ها را کم یا زیاد می کنیم و دوباره Blast می کنیم. برای مثال فرض کنید وقتی نوکئوتید C را به پرایمر مستقیم اضافه کردیم، Tm پرایمر ۲ درجه سانتیگراد بالا تر رفت. در این صورت مجبور هستیم طول پرایمر معکوس را بیشتر کنیم تا Tm آن افزایش پیدا کند. بهتر است افزودن نوکئوتیدها را از انتهای ۵ پریم پرایمر انجام دهیم. 

 

 

14

شکل ۴

 

 

 

پس از اینکه یک جفت پرایمر منایب طراحی شد و از اختصاصی بودن آن مطمئن شدیم باید احتمال تشکیل دایمر را مورد بررسی قرار دهیم. برای این منظور می توان از نرم  افزار Gene Runner و یا سایر نرم افزارهای آنلاین مانند IDT DNA استفاده کرد.

بخش چهارم   طراحي پرايمر برای بررسی بیان ژن با Real time PCR
 

اصول طراحی چرایمر های مناسب به منظور بررسی بیان ژن در یوکاریوت ها و پروکاریوت ها متفاوت است و در ادامه به این مهم در یوکاریوت ها می پردازیم.
در حال حاضر متداولترین روش در برسی کمی بیان یک ژن، Real-tim PCR  می باشد که خود شامل سه روش SYBR Green ، Hydrolysis probe (TaqMan) و Hybridization probe (Light Cycler) می باشد. در اینجا فرض بر این است که پژوهشگران محترم با اصول این روش ها آشنایی دارند. کاربرد هر یک از این روش ها با توجه به حساسیت و اختصاصیت هر یک از سه روش فوق و هدف مورد نظر در بررسی شما متفاوت است و پس از بررسی های لازم روش خود را انتخاب کنید. همانطور که می دانید در یوکاریوت ها طی مرحله پردازش اینترون ها از RNA حذف می شوند و اگزون ها به هم متصل می شوند. پرایمر ها باید حداقل در دو اگزون طراحی شوند ولی می توان طراحی را در سه و یا حتی چهار اگزون مختلف انجام داد که در دو مورد اخیر در نقاط Exon-exon junction طراحی صورت می گیرد. در صورتی که پرایمر های مستقیم و معکوس در یک اگزون طراحی شوند، آلودگی با DNA که در مرحله استخراج RNA رخ می دهد مشکل ساز خواهد شد و نتایج بررسی کاذب خواهد بود. راه حل این مشکل تیمار RNA استخراج شده با DNase می باشد، ولی می توان با طراحی مناسب پرایم و بدون نیاز به تیمار DNase به این مشکل غلبه کرد.  در طراحی پرایمر ها اصول زیر را همیشه مد نظر قرار دهید:

Tm پرایمرها باید ۵۸-۶۰ درجه سانتیگراد باشد و حداکثر اختلاف Tm پرایمرها ۱ درجه می باشد. طول پرایمر باید ۱۸ – ۳۰ باز باشد. درصد GC  پرایمر ها نزدیک هم باشد که در حالت ایده آل ۶۰-۵۰ درصد می باشد. در انتهای‌ ۳ پریم پرایمر باید حداقل یک پورین قرار گیرد ولی در عین حال باید دقت کرد که انتهای ۳ پریم غنی از پورین نباشد. از باز T در انتهای ۳ پریم پرایمر اجتناب کنید، زیرا تیمین راحتر از سایر باز ها mismatch تشکیل می دهد. طول ایده آل امپلیکون ۸۰ – ۲۰۰ باز می باشد. پرایمر ها نباید مکمل همدیگر باشند، زیرا باعث تولید پرایمر دایمر می شود. از توالی‌ های‌ پالیندرومیک‌ در پرایمر جلوگیری‌ شوند زیرا احتمال تشکیل پرایمر دایمر را افزایش می دهند. از توالی های تکراری در پرایمر، به ویژه در ۳ پریم جلوگیری شود.

در ادامه می خواهیم پرایمر هایی مناسب برای بررسی بیان ژن RB1 با روش SYBR Green طراحی کنیم. نخست توالی بزرگترین mRNA ژن مربوطه را از پایگاه Ensembl میگیریم. (به بخش نخست آموزش طراحی پرایمر مراجعه شود). در شکل ۱ رونوشت های ژن RB1 نمایش داده شده است، همانطور که مشاهده می کنید رونوشت RB1-002 بزرگترین رونوشت می باشد و پروتئینی به طول ۹۲۸ اسد آمینه کد می کند. بر روی این رونوشت کلیک می کنیم و سپس در سمت چپ گزینه Exon را انتخاب می کنیم. در صفحه جدید به توالی ۲۷ اگزون، اینترون ها و همچنین توالی های UTR ژن RB1 دسترسی خواهید داشت (شکل ۲).

 

15

شکل ۱

 

 

در شکل ۲ بخشی از توالی اگزون و اینترونی ژن RB1 به همراه طول آن ها مشاهده می شود. از آنجا که طراحی پرایمر های مستقیم و معکوس در دو اگزون آسان می باشد، بنابراین نخست به آن می پردازیم. برای این منظور دو اگزون مجاور هم را انتخاب می کنیم، طوریکه اینترون بین آن ها حداقل ۲۰۰۰ باز باشد. در شکل زیر اگزون ۲ و ۳ را انتخاب می کنیم، که به وسیله یک اینترون ۳۵۰۰۰ باز از هم جدا شده اند.

16

شکل ۲

 

 

 

 

توالی دو اگزون را پشت سر هم در نرم افزار آنلاین Primer3 وارد می کنیم و مرز دو اگزون را با علامت های [ ] از هم جدا می کنیم. در شکل شماره ۲ بخش سبز رنگ و آبی رنگ به ترتیب اگزون شماره ۲ و ۳ ژن RB1 می باشد. طول محصول را ۸۰ تا ۲۰۰ باز انتخاب می کنیم و بیشینه اختلاف دمای Tm را ۱ انتخاب می کنیم. اپتیمم دمای Tm را حدود ۶۰ انتخاب می کنیم. دو گزینه Max self complementary و Max 3′ self complemantary را ۴ و ۱ انتخاب می کنیم.

17شکل ۳

 

 

نتایج بهترین پرایمر طراحی شده برای توالی فوق در شکل ۴ قابل مشاهده است. اگر به خروجی نرم افزار Primer 3 دقت کنید در قسمت پایین صفحه سایر پرایمر های پیشنهادی را خواهید دید (در شکل ۴ نشان داده نشده است). همانطور که می بینید اختلاف Tm پرایمر مستقیم و معکوس کمتر از ۱ درجه سانتیگراد است و درصد GC آنها با هم برابر است. تنها نکته منفی در طراحی این پرایمر وجود نوکلئوتید T در انتهای ۳ پریم پرایمر معکوس می باشد. طول محصول این پرایمرها بر روی mRNA 102 باز می باشد ولی نباید DNA را امپلیفای کند. برای اطمینان از این موضوع پرایمر های مستقیم و معکوس را در Primer blast مورد برسی قرار می دهیم (شکل ۵).

 

18شکل ۴

 

 

به برای حصول اظمینان از عدم تولید محصولات غیر اختصاصی هم در RNA و DNA ابتدا به بخش Primer blast در NCBI وارد شده در بخش Primer parameters توالی پرایمر های مستقیم و معکوس را در جهت ۵ پریم به ۳ پریم وارد می کنیم. در بخش Organism گزینه Homo sapiens را تایپ کرده و در بخش Databse یکبار Genome reference را انتخاب می کنیم و یکبار گزینه Refseq RNA  را انتخاب می کنیم.

 

19

شکل ۵

 

 

همانطور که در شکل ۶ می بینید محصول این جفت پرایمر در انسان فقط در mRNA ژن RB1 به طول ۱۰۲ باز می باشد. بنابراین می توانید مطمئن باشید که در صورت وجود آلودگی DNA در هنگام استخراج RNA هیچگونه امپلیفیکاسونی صورت نخواهد گرفت، زیرا تنها محصول احتمالی این پرایمرها برروی DNA به علت طول زیاد (حدود ۴۰۰۰ باز) و وجود mismatch های متعدد، به احتمال بسیار قوی هرگز تولید نخواهد شد

20شکل ۶


بخش پنجم   طراحي پرايمر در تکنیک PCR-RFLP

PCR-RFLP یکی از روش های مرسوم در تعیین ژنوتیپ می باشد و مبتنی بر توانایی یک آنزیم محدود کننده در شناسایی و برش در یک توالی خاص می باشد (شکل ۱). 

21

شکل ۱

 

 

 

​فرض می کنیم می خواهیم پلی مورفیسم rs6869366 در ژن XRCC4 را در تعداد زیادی از افراد بیمار و کنترل ها مورد بررسی قرار دهیم. به طور خلاصه، نخست آنزیم محدود کننده مناسب را انتخاب می کنیم و سپس پرایمر را طراحی می کنیم. در پایگاه SNP که در NCBI قرار دارد شناسه پلی مورفیسم مورد نظر را وارد می کنیم (شکل ۲). در شکل ۲ نتیجه این جستجو را مشاهده می کنید. این پلی مورفیسم مربوط به گونه Homo sapiens می باشد و دارای MAF یا Minor allele frequency برابر با ۰٫۰۹۵ می باشد. در این جایگاه در افراد مختلف جمعیت یا نوکلئوتید T قرار دارد و یا G. آلل T، نوع وحشی و آلل G که فراوانی برابر با ۹٫۵ درصد دارد واریانت محسوب می شود.

22شکل ۲

به منظور انتخاب آنزیم محدود کندده مناسب به سایت NEB Cutter می رویم (شکل ۳) و توالی واقع در شکل ۲ را در باکس پایین کپی می کنیم. باید توجه کرد که یکی از دو آلل وحشی یا واریانت را وارد کنید. بهتر است آنزیمی انتخاب شود که آلل وحشی را برش دهد، زیرا فراوانی بالایی در جمعیت دارد و شما می توانید با مشاهده برش محصول PCR از صحت روش خود مطمئن شوید. ولی در صورتیکه برای آلل وحشی آنزیم محدود کننده موجود نباشد، آنزیم محدود کننده ای انتخاب می شود که آلل واریانت را برش دهد. در شکل ۳ همانطور که می بینید آلل واریانت در باکس کپی شده است.

23شکل ۳

در شکل ۴ نتیجه آنزیم هایی که توالی مورد نظر ما را برش می دهند مشاهده می کنید. برای یافتن توالی مورد نظر موس کاپپیوتر را روی نام هر آنزیم نگه دارد تا توالی مورد شناسایی و محل برش آن به شما نشان داده شود. باید توجه کنید که آنزیم مورد انتخاب شما برش های زیادی در DNA ایجاد نکند و از طرفی جایگاه پلی مورفیسم مورد برسی (که با فلش قرمز مشخص شده است) حتما با خط قرمز ممتد مشخص شده باشد. بنابراین آنزیم HincII  انتخاب می شود.

24شکل ۴

پس از انتخاب آنزیم محدود کننده مناسب در مرحله بعد پرایمر ها انتخاب می شوند. بدین منظور توالی ژن XRCC4 را از سایت پایگاه Ensembl می گیریم (به بخش نخست مراجعه شود). توالی موجود در شکل ۲ را در ژن XRCC4 پیدا می کنیم و حدود ۲۰۰ باز قبل و ۲۰۰ باز بعد از محل پلی مورفیسم را در سایت Primer 3 وارد می کنیم. با استفاده از علامت های [ و ] بخشی از توالی ژن را که پلی مورفیسم هم درون آن قرار دارد نشاندار می کنیم تا در این بخش پرایمر طراحی نشود (شکل ۵).

25

شکل ۵

در شکل ۶ نتایج این طراحی پرایمر دیده می شود. تنظیمات نرم افزار Primer3 به غیر از چند گزینه که در بخش دوم توضیح داده شد، بدون تغییر خواهد بود. در این شکل اختلاف Tm پرایمر مستقیم و معکوس حدود نیم درجه سانتیگراد می باشد و ناحیه درون براکت ها با ستاره مشخص شده است.

26شکل ۶

27شکل ۷

28

شکل ۸

29

شکل۹

30

شکل ۱۰

تهیه و تنظیم : کیومرث سلیمی نژاد (کارشناس ارشد ژنتیک)